pZLCv2-gD4Z4-1-3xFLAG-dCas9-HA-2xNLS
(Plasmid
#106352)
-
PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106352 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepZLCv2-3xFLAG-dCas9-HA-2xNLS
- Backbone size w/o insert (bp) 13000
- Total vector size (bp) 13103
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameD4Z4 gRNA-1
-
gRNA/shRNA sequenceGAACACCTGGCTGGCTACGG
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgat
- 3′ sequencing primer aacttctcggggactgtgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZLCv2-gD4Z4-1-3xFLAG-dCas9-HA-2xNLS was a gift from Stephen Tapscott (Addgene plasmid # 106352 ; http://n2t.net/addgene:106352 ; RRID:Addgene_106352) -
For your References section:
NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins. Campbell AE, Shadle SC, Jagannathan S, Lim JW, Resnick R, Tawil R, van der Maarel SM, Tapscott SJ. Elife. 2018 Mar 13;7. pii: 31023. doi: 10.7554/eLife.31023. 10.7554/eLife.31023 PubMed 29533181