Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pgRNAtet-lvaA
(Plasmid #106397)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 106397 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBbB1k-GFP
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA towards lvaA in Pseudomonas putida
  • gRNA/shRNA sequence
    gtcagtgctagctcgagcga
  • Species
    Synthetic

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgRNAtet-lvaA was a gift from Brian Pfleger (Addgene plasmid # 106397 ; http://n2t.net/addgene:106397 ; RRID:Addgene_106397)
  • For your References section:

    Genetic tools for reliable gene expression and recombineering in Pseudomonas putida. Cook TB, Rand JM, Nurani W, Courtney DK, Liu SA, Pfleger BF. J Ind Microbiol Biotechnol. 2018 Jan 3. pii: 10.1007/s10295-017-2001-5. doi: 10.1007/s10295-017-2001-5. 10.1007/s10295-017-2001-5 [pii] PubMed 29299733