Skip to main content

gh116
(Plasmid #106786)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106786 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EPB104
  • Backbone manufacturer
    Eric-Paul Bennett (Addgene plasmid # 68369)
  • Backbone size w/o insert (bp) 2376
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCNT2
  • gRNA/shRNA sequence
    ATAGCAGGTAGCTTCATCAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    GCNT2 (a.k.a. II, CCAT, IGNT, ULG3, GCNT5, GCNT2C, NACGT1, NAGCT1, MGC163396, bA421M1.1, bA360O19.2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer T7NP
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gh116 was a gift from Eric-Paul Bennett (Addgene plasmid # 106786 ; http://n2t.net/addgene:106786 ; RRID:Addgene_106786)
  • For your References section:

    A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome. Narimatsu Y, Joshi HJ, Zhang Y, Gomes C, Chen YH, Lorenzetti F, Furukawa S, Schjoldager K, Hansen L, Clausen H, Bennett EP, Wandall HH. Glycobiology. 2018 Jan 5. pii: 4791732. doi: 10.1093/glycob/cwx101. 10.1093/glycob/cwx101 PubMed 29315387