pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
(Plasmid
#107049)
-
PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9
-
gRNA/shRNA sequenceGCTTTGCGAATACGCCCACGCG
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
LacZ sgRNA for SaCas9
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA was a gift from Alex Hewitt (Addgene plasmid # 107049 ; http://n2t.net/addgene:107049 ; RRID:Addgene_107049)