MBP-rPKM2 WT
(Plasmid
#107158)
-
PurposeMBP-rPKM2 WT for production and purification of rat PKM2 WT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePCRT7
- Backbone size w/o insert (bp) 4467
- Total vector size (bp) 7277
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMBP-tagged rat pyruvate kinase M2 isoform
-
Alt namePKM, rPKM2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2810
-
Entrez GenePkm (a.k.a. PK, PKM12, Pk3, Pkm2)
- Promoter PBAD
-
Tags
/ Fusion Proteins
- C-term 6-his
- N-term MBP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer CCTACCTGACGCTTTTTATCGCAACTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MBP-rPKM2 WT was a gift from Jesse Rinehart (Addgene plasmid # 107158 ; http://n2t.net/addgene:107158 ; RRID:Addgene_107158) -
For your References section:
Distinct Hepatic PKA and CDK Signaling Pathways Control Activity-Independent Pyruvate Kinase Phosphorylation and Hepatic Glucose Production. Gassaway BM, Cardone RL, Padyana AK, Petersen MC, Judd ET, Hayes S, Tong S, Barber KW, Apostolidi M, Abulizi A, Sheetz JB, Kshitiz, Aerni HR, Gross S, Kung C, Samuel VT, Shulman GI, Kibbey RG, Rinehart J. Cell Rep. 2019 Dec 10;29(11):3394-3404.e9. doi: 10.1016/j.celrep.2019.11.009. 10.1016/j.celrep.2019.11.009 PubMed 31825824