Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

MBP-rPKM2 WT
(Plasmid #107158)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107158 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PCRT7
  • Backbone size w/o insert (bp) 4467
  • Total vector size (bp) 7277
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MBP-tagged rat pyruvate kinase M2 isoform
  • Alt name
    PKM, rPKM2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2810
  • Entrez Gene
    Pkm (a.k.a. PK, PKM12, Pk3, Pkm2)
  • Promoter PBAD
  • Tags / Fusion Proteins
    • C-term 6-his
    • N-term MBP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CCTACCTGACGCTTTTTATCGCAACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MBP-rPKM2 WT was a gift from Jesse Rinehart (Addgene plasmid # 107158 ; http://n2t.net/addgene:107158 ; RRID:Addgene_107158)
  • For your References section:

    Distinct Hepatic PKA and CDK Signaling Pathways Control Activity-Independent Pyruvate Kinase Phosphorylation and Hepatic Glucose Production. Gassaway BM, Cardone RL, Padyana AK, Petersen MC, Judd ET, Hayes S, Tong S, Barber KW, Apostolidi M, Abulizi A, Sheetz JB, Kshitiz, Aerni HR, Gross S, Kung C, Samuel VT, Shulman GI, Kibbey RG, Rinehart J. Cell Rep. 2019 Dec 10;29(11):3394-3404.e9. doi: 10.1016/j.celrep.2019.11.009. 10.1016/j.celrep.2019.11.009 PubMed 31825824