JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry
              
              
                (Plasmid
                
                #107246)
              
            
            
            
          - 
            PurposehM3DREADD fused to ABIcs for abscisic acid mediated recruitment of PYLcs labelled proteins.
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneAAV2
 - Backbone size w/o insert (bp) 6597
 - Total vector size (bp) 8454
 - 
              Vector typeAAV
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert namehM3DREADD
 - 
                  Alt nameGq DREADD
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)1776
 - 
                  MutationT to D and S to D mutations in V2-tail
 - Promoter hSYN
 - 
    
        Tags
        / Fusion Proteins
    
- FLAG (N terminal on insert)
 - ABIcs (C terminal on insert)
 - mCherry (N terminal on insert)
 
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer cgctgcctcagtctgcggtg
 - 3′ sequencing primer ggagaaaatgaaagccatacgggaagcaatag (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/01/22/251769 for bioRxiv preprint.
These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry was a gift from Bryan Roth (Addgene plasmid # 107246 ; http://n2t.net/addgene:107246 ; RRID:Addgene_107246) - 
                
For your References section:
A Chemogenetic Platform for Spatio-temporal Control of β-arrestin Translocation and Signaling at G protein-Coupled Receptors. Roth BL, Gotoh Y, Giguere P, Nichols D. bioRxiv 251769 /10.1101/251769