Skip to main content
Addgene

JGE302_pAAV-hSyn-DIO-Myc-PYLcs-bArrestin2-YFP (p2)
(Plasmid #107247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 6597
  • Total vector size (bp) 8454
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ARRB2
  • Alt name
    Beta Arrestin 2
  • Species
    Synthetic
  • Insert Size (bp)
    1962
  • Promoter hSYN
  • Tags / Fusion Proteins
    • MYC (N terminal on insert)
    • PYLcs (N terminal on insert)
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgctgcctcagtctgcggtg
  • 3′ sequencing primer ggagaaaatgaaagccatacgggaagcaatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/01/22/251769 for bioRxiv preprint.

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JGE302_pAAV-hSyn-DIO-Myc-PYLcs-bArrestin2-YFP (p2) was a gift from Bryan Roth (Addgene plasmid # 107247 ; http://n2t.net/addgene:107247 ; RRID:Addgene_107247)
  • For your References section:

    A Chemogenetic Platform for Spatio-temporal Control of β-arrestin Translocation and Signaling at G protein-Coupled Receptors. Roth BL, Gotoh Y, Giguere P, Nichols D. bioRxiv 251769 /10.1101/251769