Skip to main content

pX-APRT-sg2
(Plasmid #107274)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107274 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APRT sgRNA-2
  • gRNA/shRNA sequence
    GGCAGCGTTCATGGTTCCTG
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX-APRT-sg2 was a gift from Knut Woltjen (Addgene plasmid # 107274 ; http://n2t.net/addgene:107274 ; RRID:Addgene_107274)
  • For your References section:

    Microhomology-assisted scarless genome editing in human iPSCs. Kim SI, Matsumoto T, Kagawa H, Nakamura M, Hirohata R, Ueno A, Ohishi M, Sakuma T, Soga T, Yamamoto T, Woltjen K. Nat Commun. 2018 Mar 5;9(1):939. doi: 10.1038/s41467-018-03044-y. 10.1038/s41467-018-03044-y PubMed 29507284