RINS1(mut)
(Plasmid
#107291)
-
PurposePlasmid for the expression of the inactive mutant of RINS1 sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneC1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin, mCherry, sfGFP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRINS1(mut)
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1812
-
Mutationtwo Arg/Ser mutations at the beginning and in the end of the C-chain of insulin to prevent the cleavege of C-peptide upon insulin maturation
- Promoter CMV
-
Tag
/ Fusion Protein
- sfGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG; pEGFP-FP:TTTAGTGAACCGTCAGATC
- 3′ sequencing primer pEGFP_C2-RP: TTTAAAGCAAGTAAAACCTC; SV40pA-R: GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RINS1(mut) was a gift from Dmytro Yushchenko (Addgene plasmid # 107291 ; http://n2t.net/addgene:107291 ; RRID:Addgene_107291) -
For your References section:
A Ratiometric Sensor for Imaging Insulin Secretion in Single beta Cells. Schifferer M, Yushchenko DA, Stein F, Bolbat A, Schultz C. Cell Chem Biol. 2017 Apr 20;24(4):525-531.e4. doi: 10.1016/j.chembiol.2017.03.001. Epub 2017 Mar 30. 10.1016/j.chembiol.2017.03.001 PubMed 28366620