pCOLA banana sensor sfGFP
(Plasmid
#107367)
-
PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when exposed to extracted and RPA-amplified banana DNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCOLADuet-1
-
Backbone manufacturerNovagen 71406-3
- Backbone size w/o insert (bp) 3340
- Total vector size (bp) 4160
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Turbo
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebanana-detecting toehold + sfGFP
-
Insert Size (bp)820
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttttcccgcgttttcgca
- 3′ sequencing primer ctagcataaccccttggggc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCOLA banana sensor sfGFP was a gift from James Collins (Addgene plasmid # 107367 ; http://n2t.net/addgene:107367 ; RRID:Addgene_107367) -
For your References section:
BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608