pJL1 eforRed
(Plasmid
#106320)
-
PurposeExpresses eforRed (an RFP derivative) in Ecoli off a T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJL1
-
Backbone manufacturerMichael Jewett Lab
- Backbone size w/o insert (bp) 2724
- Total vector size (bp) 2874
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeforRed
-
Insert Size (bp)684
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAATTAATACGACTCACTATAGGGAGACC
- 3′ sequencing primer GCTCGAGGTTATCCGGATATAGTTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byiGEM Part BBa_K592012
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1 eforRed was a gift from James Collins (Addgene plasmid # 106320 ; http://n2t.net/addgene:106320 ; RRID:Addgene_106320) -
For your References section:
BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608