pJKW0474
(Plasmid
#107588)
-
Purpose(Empty Backbone) pCLV3:Cas9
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEarleyGate100
-
Backbone manufacturerKeith Earley and Craig Pikaard
- Backbone size (bp) 11648
-
Modifications to backbonepCLV3-hSpCsn1-CLV3ter fragment was first assembled by Gibson Assembly using the following three PCR fragment: Fragment 1 CLV3 Promoter 1480bp, At genomic DNA as template F: actgatttgaaaaatctcag aattccggattatccataataa JKW1005 R: CTTATAGTCCAT ttttagagagaaagtgactgagtg JKW1006 Fragment 2 CAS9, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) as template F: Ttctctctaaaa ATGGACTATAAGGACCACGAC JKW1007 R: Caagagattagg ttaCTTTTTCTTTTTTGCCTGG JKW1008 Fragment 3 CLV3 Terminator 1357bp, At genomic DNA as template F: AAGAAAAAGtaa cctaatctcttgttgctttaaa JKW1009 R: gccaagcttgcatgcctgca gg aattttttaaaaaaatagttaattatc JKW1010 The Gibson assembly reaction as used as template to amply this assembled fragment using primer pair JKW1105 and JKW1010. This fragment together with EcoR I and Sbf I digested pEARLEYGATE100 are used in a new Gibson assembly to make the final construct. The SbfI site can be used to clone in guide RNA fragment.
-
Vector typePlant Expression, CRISPR
- Promoter Arabidopsis CLAVATA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctactctctctgttcatttttg
- 3′ sequencing primer GACGTTGTAAAACGACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJKW0474 was a gift from Jing-Ke Weng (Addgene plasmid # 107588 ; http://n2t.net/addgene:107588 ; RRID:Addgene_107588)