DRH323: pAAV_hSyn-QuasAr2
(Plasmid
#107705)
-
Purposein vivo voltage imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV_hSyn
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7149
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQuasAr2
-
SpeciesSynthetic
-
Insert Size (bp)1500
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer ctctgctgtttatggtgttggacg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DRH323: pAAV_hSyn-QuasAr2 was a gift from Adam Cohen (Addgene plasmid # 107705 ; http://n2t.net/addgene:107705 ; RRID:Addgene_107705) -
For your References section:
Voltage imaging and optogenetics reveal behaviour-dependent changes in hippocampal dynamics. Adam Y, Kim JJ, Lou S, Zhao Y, Xie ME, Brinks D, Wu H, Mostajo-Radji MA, Kheifets S, Parot V, Chettih S, Williams KJ, Gmeiner B, Farhi SL, Madisen L, Buchanan EK, Kinsella I, Zhou D, Paninski L, Harvey CD, Zeng H, Arlotta P, Campbell RE, Cohen AE. Nature. 2019 May 1. pii: 10.1038/s41586-019-1166-7. doi: 10.1038/s41586-019-1166-7. 10.1038/s41586-019-1166-7 PubMed 31043747