pSpCas9_BB_2A-GFP_MAPRE3-gRNA#1
(Plasmid
#107729)
-
PurposeKnock out of EB3 in human cells by CRISPR/Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (Addgene #48138)
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 9288
- Total vector size (bp) 9291
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAPRE3 gRNA #1 (targets Exon 1)
-
Alt nameEB3
-
gRNA/shRNA sequenceGTCGCCATGATATGCTTGCA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001303050.1
-
Entrez GeneMAPRE3 (a.k.a. EB3, EBF3, EBF3-S, RP3)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For a detailed protocol on knocking out EB1 in human cell lines by CRISPR/Cas9, see our protocol on "Protocol Exchange" (doi and link can be found below)
For rapidly cloning gRNA sequences into pSpCAS9(BB)-2a-GFP in a single RE digestion/ ligation step, see support protocol 3
Generation of cell lines with light-controlled microtubule dynamics
Torsten Wittmann & Jeffrey van Haren
Protocol Exchange (2018) doi:10.1038/protex.2017.155
https://www.nature.com/protocolexchange/protocols/6427
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#1 was a gift from Torsten Wittmann (Addgene plasmid # 107729 ; http://n2t.net/addgene:107729 ; RRID:Addgene_107729) -
For your References section:
Local control of intracellular microtubule dynamics by EB1 photodissociation. van Haren J, Charafeddine RA, Ettinger A, Wang H, Hahn KM, Wittmann T. Nat Cell Biol. 2018 Jan 29. pii: 10.1038/s41556-017-0028-5. doi: 10.1038/s41556-017-0028-5. 10.1038/s41556-017-0028-5 [pii] PubMed 29379139