AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3
(Plasmid
#107736)
-
PurposeIn the presence of Cre, can be used to express both GCaMP6s fused to the presynaptic protein synaptophysin and independently the red-fluorescent protein mRuby3.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CW3SL-EGFP
-
Backbone manufacturerBong-Kiun Kaang
- Backbone size w/o insert (bp) 3372
- Total vector size (bp) 7305
-
Modifications to backboneA fragment containing the nEF promoter, LoxP/Lox2272, and reverse-complemented Synaptophysin-GCaMP6s.P2A.mRuby3 was swapped into replace EGFP and the shortened CamKII promoter in the CW3SL backbone. Total AAV packaging size (including ITRs and DNA in between) is 4681 bp.
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesynaptophysin-GCaMP6s, mRuby3
-
Alt namesynaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
-
Alt namemRuby3
-
SpeciesR. norvegicus (rat); A. victoria (jellyfish)
-
GenBank ID24804
- Promoter nEF
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Pci (not destroyed)
- 3′ cloning site SciI (destroyed during cloning)
- 5′ sequencing primer CCTGGCCTTTTGCTGGCCTTTTGC
- 3′ sequencing primer ATCCAGAGGTTGATTATCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004. mRuby3 sequence synthesis was based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3 was a gift from Rylan Larsen (Addgene plasmid # 107736 ; http://n2t.net/addgene:107736 ; RRID:Addgene_107736)