-
PurposeExpress Chrimson and mCherry in mechanosensory neurons.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAL
-
Vector typeWorm Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChrimson
-
SpeciesSynthetic; Chlamydomonas noctigama
-
Insert Size (bp)1050
- Promoter mec-4
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaccatgtgaagacatgagc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Insert Size (bp)860
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ccatttcctcgtttttgcgag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmec-4::Chrimson::SL2::mCherry::unc-54 was a gift from Andrew Leifer (Addgene plasmid # 107745 ; http://n2t.net/addgene:107745 ; RRID:Addgene_107745) -
For your References section:
Temporal processing and context dependency in Caenorhabditis elegans response to mechanosensation. Liu M, Sharma AK, Shaevitz JW, Leifer AM. Elife. 2018 Jun 26;7. pii: 36419. doi: 10.7554/eLife.36419. 10.7554/eLife.36419 PubMed 29943731