Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMEL16
(Plasmid #107922)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107922 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p426-SNR52p-gRNA.CAN1.Y-SUP4t
  • Backbone manufacturer
    George Church (Addgene plasmid # 43803)
  • Backbone size w/o insert (bp) 5775
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA-CAN1.Y
  • gRNA/shRNA sequence
    GATACGTTCTCTATGGAGGA
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMEL16 was a gift from Jean-Marc Daran (Addgene plasmid # 107922 ; http://n2t.net/addgene:107922 ; RRID:Addgene_107922)
  • For your References section:

    CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. FEMS Yeast Res. 2015 Mar;15(2). pii: fov004. doi: 10.1093/femsyr/fov004. Epub 2015 Mar 4. 10.1093/femsyr/fov004 PubMed 25743786