pTol2-UAS-zmiRFP
              
              
                (Plasmid
                
                #108415)
              
            
            
            
          - 
            PurposeCodon-optimized monomeric near-infrared fluorescent protein miRFP in zebrafish expression plasmid
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTol2-UAS
 - 
              Vector typeZebrafish
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namezmiRFP
 - 
                  Alt namezebrafish codon-optimized miRFP
 - 
                    SpeciesSynthetic
 - 
                    GenBank IDMG250279.1
 - Promoter UAS
 
Cloning Information
- Cloning method Ligation Independent Cloning
 - 5′ sequencing primer acccagctttcttgtacaaa
 - 3′ sequencing primer ggccgtatcttcgc (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pTol2-UAS-zmiRFP was a gift from Edward Boyden (Addgene plasmid # 108415 ; http://n2t.net/addgene:108415 ; RRID:Addgene_108415) - 
                
For your References section:
A robotic multidimensional directed evolution approach applied to fluorescent voltage reporters. Piatkevich KD, Jung EE, Straub C, Linghu C, Park D, Suk HJ, Hochbaum DR, Goodwin D, Pnevmatikakis E, Pak N, Kawashima T, Yang CT, Rhoades JL, Shemesh O, Asano S, Yoon YG, Freifeld L, Saulnier JL, Riegler C, Engert F, Hughes T, Drobizhev M, Szabo B, Ahrens MB, Flavell SW, Sabatini BL, Boyden ES. Nat Chem Biol. 2018 Feb 26. pii: 10.1038/s41589-018-0004-9. doi: 10.1038/s41589-018-0004-9. 10.1038/s41589-018-0004-9 PubMed 29483642