-
PurposeFor production of retrovirus and transduction of mammalian cells, allowing expression of N-terminally eGFP-tagged human cGAS
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108674 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCVpuro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6264
- Total vector size (bp) 8655
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP-cGAS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2385
-
Entrez GeneCGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVpuro-eGFP-hcGAS was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108674 ; http://n2t.net/addgene:108674 ; RRID:Addgene_108674) -
For your References section:
cGAS surveillance of micronuclei links genome instability to innate immunity. Mackenzie KJ, Carroll P, Martin CA, Murina O, Fluteau A, Simpson DJ, Olova N, Sutcliffe H, Rainger JK, Leitch A, Osborn RT, Wheeler AP, Nowotny M, Gilbert N, Chandra T, Reijns MAM, Jackson AP. Nature. 2017 Aug 24;548(7668):461-465. doi: 10.1038/nature23449. Epub 2017 Jul 24. 10.1038/nature23449 PubMed 28738408