Skip to main content

pGEX6P1-hcGAS(157-522)
(Plasmid #108676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX6P1
  • Backbone manufacturer
    Amersham
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 6072
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cGAS amino acid 157-522
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1101
  • Mutation
    contains amino acid 157-522
  • Entrez Gene
    CGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-hcGAS(157-522) was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108676 ; http://n2t.net/addgene:108676 ; RRID:Addgene_108676)
  • For your References section:

    cGAS surveillance of micronuclei links genome instability to innate immunity. Mackenzie KJ, Carroll P, Martin CA, Murina O, Fluteau A, Simpson DJ, Olova N, Sutcliffe H, Rainger JK, Leitch A, Osborn RT, Wheeler AP, Nowotny M, Gilbert N, Chandra T, Reijns MAM, Jackson AP. Nature. 2017 Aug 24;548(7668):461-465. doi: 10.1038/nature23449. Epub 2017 Jul 24. 10.1038/nature23449 PubMed 28738408