Skip to main content

CAG-mCherry
(Plasmid #108685)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108685 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE1
  • Backbone size w/o insert (bp) 4888
  • Total vector size (bp) 5599
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    795
  • Promoter CAG

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TACAGCTCCTGGGCAACGTG
  • 3′ sequencing primer CCC ATA TGT CCT TCC GAG TG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Karl Wahlin
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/02/13/264390 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-mCherry was a gift from Jordan Green (Addgene plasmid # 108685 ; http://n2t.net/addgene:108685 ; RRID:Addgene_108685)
  • For your References section:

    A combinatorial library of biodegradable polyesters enables non-viral gene delivery to post-mitotic human stem cell-derived polarized RPE monolayers. Mishra B, Wilson DR, Sripathi SR, Suprenant MP, Rui Y, Wahlin KJ, Berlinicke CA, Green JJ, Zack DJ. Regen Eng Transl Med. 2019 Sep;6(3):273-285. doi: 10.1007/s40883-019-00118-1. Epub 2019 Jul 24. 10.1007/s40883-019-00118-1 PubMed 33732871