Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pScDD2_ERdd
(Plasmid #109047)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109047 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSc with SOD1 promoter
  • Backbone size w/o insert (bp) 6292
  • Total vector size (bp) 7765
  • Vector type
    Yeast Expression
  • Selectable markers
    KanMX4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER50
  • Alt name
    ERLBD
  • Alt name
    ERS1 ligand binding domain
  • Species
    H. sapiens gene with yeast enhanced codon
  • Insert Size (bp)
    1473
  • Mutation
    3 mutations : E380G, R434G, N532S
  • GenBank ID
    BC128573.1
  • Entrez Gene
    ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
  • Promoter SOD1
  • Tag / Fusion Protein
    • yeast enhanced GFP with 8 amino acids TSGRGEGQ linker (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GCTGTAACTATGTTGCGGAA ( in SOD promoter) or CCTTATCCAAAGATCCAAACG ( in yeGFP)
  • 3′ sequencing primer TAGACAAGCCGACAACCTTG ( in ADH1 terminator)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScDD2_ERdd was a gift from Thomas Wandless (Addgene plasmid # 109047 ; http://n2t.net/addgene:109047 ; RRID:Addgene_109047)