pInducer20-Blast-CDT1-HA
(Plasmid
#109335)
-
Purposevirus packaged, doxycyline inducible expression of Cdt1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepInducer20-Blast
-
Vector typeMammalian Expression, Lentiviral ; Inducible expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCdt1
-
SpeciesH. sapiens (human)
-
GenBank IDNM_030928
-
Entrez GeneCDT1 (a.k.a. DUP, RIS2)
-
Tag
/ Fusion Protein
- HA, His, Strep (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCATAGAAGACACCGGGACC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer20-Blast-CDT1-HA was a gift from Jean Cook (Addgene plasmid # 109335 ; http://n2t.net/addgene:109335 ; RRID:Addgene_109335) -
For your References section:
Rapid DNA replication origin licensing protects stem cell pluripotency. Matson JP, Dumitru R, Coryell P, Baxley RM, Chen W, Twaroski K, Webber BR, Tolar J, Bielinsky AK, Purvis JE, Cook JG. Elife. 2017 Nov 17;6. doi: 10.7554/eLife.30473. 10.7554/eLife.30473 PubMed 29148972