Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #109424)


Item Catalog # Description Quantity Price (USD)
Plasmid 109424 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Merck - Novagen
  • Total vector size (bp) 6253
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    biotin ligase
  • Insert Size (bp)
  • Entrez Gene
    birA (a.k.a. b3973, ECK3965, bioR, dhbB)
  • Promoter T7
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21d-myc-BirA was a gift from Martin Spiess (Addgene plasmid # 109424)
  • For your References section:

    A versatile nanobody-based toolkit to analyze retrograde transport from the cell surface. Buser DP, Schleicher KD, Prescianotto-Baschong C, Spiess M. PNAS June 18, 2018. 201801865 10.1073/pnas.1801865115