mCherry Codon 59 sgRNA
(Plasmid
#109431)
-
PurposeMLM3636 backbone containing a gRNA that guides Cas9 to codon 59 of mCherry in the ACE reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerJoung Lab
- Backbone size w/o insert (bp) 2271
- Total vector size (bp) 2279
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry codon 59 gRNA
-
Alt name#59 gRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter hU6
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
- 3′ sequencing primer CGGTGCCACTTTTTCAAGTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry Codon 59 sgRNA was a gift from Reuben Harris (Addgene plasmid # 109431 ; http://n2t.net/addgene:109431 ; RRID:Addgene_109431) -
For your References section:
A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667