Non-specific sgRNA
(Plasmid
#109432)
-
PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerJoung Lab
- Backbone size w/o insert (bp) 2259
- Total vector size (bp) 2279
-
Modifications to backboneInsertion of a 20 bp sequence that is non-specific and does not bind in the human genome into the gRNA backbone
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNon-specific gRNA
-
Alt nameNS gRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter hU6
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
- 3′ sequencing primer CGGTGCCACTTTTTCAAGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Non-specific sgRNA was a gift from Reuben Harris (Addgene plasmid # 109432 ; http://n2t.net/addgene:109432 ; RRID:Addgene_109432) -
For your References section:
A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667