Skip to main content

Non-specific sgRNA
(Plasmid #109432)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109432 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MLM3636
  • Backbone manufacturer
    Joung Lab
  • Backbone size w/o insert (bp) 2259
  • Total vector size (bp) 2279
  • Modifications to backbone
    Insertion of a 20 bp sequence that is non-specific and does not bind in the human genome into the gRNA backbone
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Non-specific gRNA
  • Alt name
    NS gRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter hU6

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
  • 3′ sequencing primer CGGTGCCACTTTTTCAAGTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Non-specific sgRNA was a gift from Reuben Harris (Addgene plasmid # 109432 ; http://n2t.net/addgene:109432 ; RRID:Addgene_109432)
  • For your References section:

    A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667