Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Lenti-TetON-Sox2
(Plasmid #110280)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110280 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCWtre-hpaI-pacI-rtTAiBlast
  • Backbone size w/o insert (bp) 9501
  • Total vector size (bp) 10461
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRY (sex determining region Y)-box 2
  • Alt name
    Sox2
  • Alt name
    lcc
  • Alt name
    ysb
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    960
  • Mutation
    Wild type
  • GenBank ID
    NM_011443.4
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Promoter TRE
  • Tag / Fusion Protein
    • No fusion genes

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer AGAACGTATGTCGAGGTAGGCG
  • 3′ sequencing primer GGCCAGATCTTGGGTGGGTTAATTAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-TetON-Sox2 was a gift from Trudy Oliver (Addgene plasmid # 110280 ; http://n2t.net/addgene:110280 ; RRID:Addgene_110280)
  • For your References section:

    The Lineage-Defining Transcription Factors SOX2 and NKX2-1 Determine Lung Cancer Cell Fate and Shape the Tumor Immune Microenvironment. Mollaoglu G, Jones A, Wait SJ, Mukhopadhyay A, Jeong S, Arya R, Camolotto SA, Mosbruger TL, Stubben CJ, Conley CJ, Bhutkar A, Vahrenkamp JM, Berrett KC, Cessna MH, Lane TE, Witt BL, Salama ME, Gertz J, Jones KB, Snyder EL, Oliver TG. Immunity. 2018 Oct 16;49(4):764-779.e9. doi: 10.1016/j.immuni.2018.09.020. 10.1016/j.immuni.2018.09.020 PubMed 30332632