ins:BB1.0L; cryaa:RFP
(Plasmid
#110283)
-
PurposeA zebrafish insulin promoter driving the Brainbow (BB1.0L) cassette. Contains red eye marker, and is flanked with I-SceI sites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKS-ins:MCS; cryaa:RFP
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 9940
-
Vector typeZebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrainbow1.0L
-
SpeciesSynthetic
-
Insert Size (bp)3300
- Promoter insulin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer ACACCCTGGTCATCATCCTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Brainbow1.0L fragment obtained from Addgene Plasmid Number: 18725 (Thy1-Brainbow-1.0 L).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ins:BB1.0L; cryaa:RFP was a gift from Nikolay Ninov (Addgene plasmid # 110283 ; http://n2t.net/addgene:110283 ; RRID:Addgene_110283) -
For your References section:
Different developmental histories of beta-cells generate functional and proliferative heterogeneity during islet growth. Singh SP, Janjuha S, Hartmann T, Kayisoglu O, Konantz J, Birke S, Murawala P, Alfar EA, Murata K, Eugster A, Tsuji N, Morrissey ER, Brand M, Ninov N. Nat Commun. 2017 Sep 22;8(1):664. doi: 10.1038/s41467-017-00461-3. 10.1038/s41467-017-00461-3 [pii] PubMed 28939870