Skip to main content

ins:BB1.0L; cryaa:RFP
(Plasmid #110283)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110283 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKS-ins:MCS; cryaa:RFP
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 9940
  • Vector type
    Zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Brainbow1.0L
  • Species
    Synthetic
  • Insert Size (bp)
    3300
  • Promoter insulin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer ACACCCTGGTCATCATCCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Brainbow1.0L fragment obtained from Addgene Plasmid Number: 18725 (Thy1-Brainbow-1.0 L).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ins:BB1.0L; cryaa:RFP was a gift from Nikolay Ninov (Addgene plasmid # 110283 ; http://n2t.net/addgene:110283 ; RRID:Addgene_110283)
  • For your References section:

    Different developmental histories of beta-cells generate functional and proliferative heterogeneity during islet growth. Singh SP, Janjuha S, Hartmann T, Kayisoglu O, Konantz J, Birke S, Murawala P, Alfar EA, Murata K, Eugster A, Tsuji N, Morrissey ER, Brand M, Ninov N. Nat Commun. 2017 Sep 22;8(1):664. doi: 10.1038/s41467-017-00461-3. 10.1038/s41467-017-00461-3 [pii] PubMed 28939870