pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
(Plasmid
#110300)
-
PurposeExpresssion of Cas9-T2A-neomycin resistant gene and a gRNA targeting exon 10 of human 53BP1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110300 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459)
-
Backbone manufacturerFeng Zhang, Addgene plasmid #48139
-
Modifications to backbonePuromycin is replaced by Neomycin resistant gene
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep53-binding protein 1
-
gRNA/shRNA sequenceGGACTGCTAGGAACGATAAA
-
SpeciesH. sapiens (human)
-
Entrez GeneTP53BP1 (a.k.a. 53BP1, TDRD30, p202, p53BP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D was a gift from Chris Kok-Lung Chan (Addgene plasmid # 110300 ; http://n2t.net/addgene:110300 ; RRID:Addgene_110300) -
For your References section:
PLK1 facilitates chromosome biorientation by suppressing centromere disintegration driven by BLM-mediated unwinding and spindle pulling. Addis Jones O, Tiwari A, Olukoga T, Herbert A, Chan KL. Nat Commun. 2019 Jun 28;10(1):2861. doi: 10.1038/s41467-019-10938-y. 10.1038/s41467-019-10938-y PubMed 31253795