-
PurposeMammalian expression of FLAG-tagged SOX4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3-Flag-FKHR
-
Backbone manufacturerWilliam Sellers
-
Modifications to backbonerestricted with BamHI and XbaI to remove FKHR insert
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX4
-
SpeciesH. sapiens (human)
-
Mutationlacking 5' UTR
-
Entrez GeneSOX4 (a.k.a. CSS10, EVI16)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer SOX4 primer (TTGCCGGACTTCACCTTCTTCCT)
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-FLAG-SOX4 was a gift from Carlos Moreno (Addgene plasmid # 110360 ; http://n2t.net/addgene:110360 ; RRID:Addgene_110360) -
For your References section:
Sex-determining region Y box 4 is a transforming oncogene in human prostate cancer cells. Liu P, Ramachandran S, Ali Seyed M, Scharer CD, Laycock N, Dalton WB, Williams H, Karanam S, Datta MW, Jaye DL, Moreno CS. Cancer Res. 2006 Apr 15;66(8):4011-9. doi: 10.1158/0008-5472.CAN-05-3055. 10.1158/0008-5472.CAN-05-3055 PubMed 16618720