Skip to main content
Addgene

pcDNA3-FLAG-SOX4
(Plasmid #110360)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110360 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3-Flag-FKHR
  • Backbone manufacturer
    William Sellers
  • Modifications to backbone
    restricted with BamHI and XbaI to remove FKHR insert
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOX4
  • Species
    H. sapiens (human)
  • Mutation
    lacking 5' UTR
  • Entrez Gene
    SOX4 (a.k.a. CSS10, EVI16)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SOX4 primer (TTGCCGGACTTCACCTTCTTCCT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-FLAG-SOX4 was a gift from Carlos Moreno (Addgene plasmid # 110360 ; http://n2t.net/addgene:110360 ; RRID:Addgene_110360)
  • For your References section:

    Sex-determining region Y box 4 is a transforming oncogene in human prostate cancer cells. Liu P, Ramachandran S, Ali Seyed M, Scharer CD, Laycock N, Dalton WB, Williams H, Karanam S, Datta MW, Jaye DL, Moreno CS. Cancer Res. 2006 Apr 15;66(8):4011-9. doi: 10.1158/0008-5472.CAN-05-3055. 10.1158/0008-5472.CAN-05-3055 PubMed 16618720