tet-pLKO.neo_shGFP
(Plasmid
#110470)
-
PurposeControl, silence GFP gene, doxycycline inducible, neomycin selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTet-pLKO-neo
-
Backbone manufacturer#21916
- Backbone size w/o insert (bp) 10959
- Total vector size (bp) 9142
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceCAAGCTGACCCTGAAGTTCAT
-
SpeciesSynthetic
- Promoter H1/TO (RNA PolIII)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet-pLKO.neo_shGFP was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110470 ; http://n2t.net/addgene:110470 ; RRID:Addgene_110470) -
For your References section:
Dual inhibition of glutaminase and carnitine palmitoyltransferase decreases growth and migration of glutaminase inhibition-resistant triple-negative breast cancer cells. Reis LMD, Adamoski D, Ornitz Oliveira Souza R, Rodrigues Ascencao CF, Sousa de Oliveira KR, Correa-da-Silva F, Malta de Sa Patroni F, Meira Dias M, Consonni SR, Mendes de Moraes-Vieira PM, Silber AM, Dias SMG. J Biol Chem. 2019 Jun 14;294(24):9342-9357. doi: 10.1074/jbc.RA119.008180. Epub 2019 Apr 30. 10.1074/jbc.RA119.008180 PubMed 31040181