H52-pUCM-hNGN2-inv
(Plasmid
#110492)
-
PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuron, TALEN cut site outside of homology arm
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUCM
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10709
-
Vector typeMammalian Expression, Cre/Lox, CRISPR, TALEN
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNeurogenin 2
-
Alt nameNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)819
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemcherry
-
Alt namemcherry
-
Speciessynthetic
-
Insert Size (bp)702
- Promoter EF-1 alpha
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgcctacgctagcgctac
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namertTA3G
-
Alt namertTA3G
-
Insert Size (bp)747
- Promoter CAG
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggttattgtgctgtctc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H52-pUCM-hNGN2-inv was a gift from Michael Ward (Addgene plasmid # 110492 ; http://n2t.net/addgene:110492 ; RRID:Addgene_110492)