pJM100 (pUC18T-miniTn7T-gm-araC-ParaBAD)
(Plasmid
#110554)
-
PurposeminiTn7 delivery plasmid with araC-ParaBAD inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC18T-miniTn7T-gm
-
Backbone manufacturerHerbert Schweizer
- Backbone size w/o insert (bp) 4569
- Total vector size (bp) 5780
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namearaC-ParaBAD
-
Insert Size (bp)1235
-
GenBank IDKX787911
- Promoter AraC-ParaBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer pBAD Forward (ATGCCATAGCATTTTTATCC)
- 3′ sequencing primer Tn7-end (GGGGTGGAAATGGAGTTTTT ) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM100 (pUC18T-miniTn7T-gm-araC-ParaBAD) was a gift from Joanna Goldberg (Addgene plasmid # 110554 ; http://n2t.net/addgene:110554 ; RRID:Addgene_110554) -
For your References section:
The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa. Meisner J, Goldberg JB. Appl Environ Microbiol. 2016 Oct 27;82(22):6715-6727. doi: 10.1128/AEM.02041-16. Print 2016 Nov 15. 10.1128/AEM.02041-16 PubMed 27613678