pMS73
(Plasmid
#110629)
-
PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicating
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNEBUC
-
Backbone manufacturerWeinzierl et al., 2002, Mol. Microbiol. 45
- Total vector size (bp) 10784
-
Vector typeBacterial Expression, CRISPR ; Self-replicating in Ustilago maydis, conferring carboxin resistance
-
Selectable markersCarboxin resistance conferred by mutated ip gene
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameshort U6 promoter
-
SpeciesUstilago maydis
-
Insert Size (bp)304
-
MutationTruncated version of the U6 promoter comprising 304 bp compared to 826 bp in pCas9_sgRNA_0
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
- 3′ sequencing primer TGTAGCACACGACTCACATC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecas9
-
SpeciesSynthetic
-
Insert Size (bp)5393
-
MutationStreptococcus pyogenes gene codon-optimized for Ustilago maydis
- Promoter U. maydis hsp70 promoter (Kronstad and Leong, 1989 Proc. Natl. Acad. Sci. USA 86)
-
Tag
/ Fusion Protein
- N-terminal NLS, C-terminal HA-tag +NLS (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACAGCGATCCTGCTATTCC
- 3′ sequencing primer CAAGACCGGCAACAGGATTC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametnos terminator
-
SpeciesAgrobacterium tumefaciens
-
Insert Size (bp)291
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS73 was a gift from Regine Kahmann (Addgene plasmid # 110629 ; http://n2t.net/addgene:110629 ; RRID:Addgene_110629) -
For your References section:
Comparative analyses of secreted proteins in plant pathogenic smut fungi and related basidiomycetes. Schuster M, Schweizer G, Kahmann R. Fungal Genet Biol. 2018 Mar;112:21-30. doi: 10.1016/j.fgb.2016.12.003. Epub 2017 Jan 6. 10.1016/j.fgb.2016.12.003 PubMed 28089076