Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCR1162
(Plasmid #111098)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111098 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR1068
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FANCA gRNA
  • gRNA/shRNA sequence
    GTTGGCGCCTACAGCCCCGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    FANCA (a.k.a. FA, FA-H, FA1, FAA, FACA, FAH, FANCH)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR1162 was a gift from Jacob Corn (Addgene plasmid # 111098 ; http://n2t.net/addgene:111098 ; RRID:Addgene_111098)
  • For your References section:

    CRISPR-Cas9 genome editing in human cells occurs via the Fanconi anemia pathway. Richardson CD, Kazane KR, Feng SJ, Zelin E, Bray NL, Schafer AJ, Floor SN, Corn JE. Nat Genet. 2018 Aug;50(8):1132-1139. doi: 10.1038/s41588-018-0174-0. Epub 2018 Jul 27. 10.1038/s41588-018-0174-0 PubMed 30054595