Skip to main content

pCR1280
(Plasmid #111123)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111123 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR1068
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    XRCC3 gRNA
  • gRNA/shRNA sequence
    GGGAGTGCGGAACCCGCGGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    XRCC3 (a.k.a. CMM6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR1280 was a gift from Jacob Corn (Addgene plasmid # 111123 ; http://n2t.net/addgene:111123 ; RRID:Addgene_111123)
  • For your References section:

    CRISPR-Cas9 genome editing in human cells occurs via the Fanconi anemia pathway. Richardson CD, Kazane KR, Feng SJ, Zelin E, Bray NL, Schafer AJ, Floor SN, Corn JE. Nat Genet. 2018 Aug;50(8):1132-1139. doi: 10.1038/s41588-018-0174-0. Epub 2018 Jul 27. 10.1038/s41588-018-0174-0 PubMed 30054595