-
PurposeExpresses Venus YFP with a C-terminal SMASh(TI) tag fusion in mammalian cells. [TI = telaprevir inhibited].
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-SPORT6
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 8340
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYFP-SMASh(TI)
-
SpeciesAequorea victoria, Hepatitis C Virus (HCV) genotype 1a
-
Insert Size (bp)1758
-
MutationThe HCV NS3 protease carries F43L, Q80K, S122R, and D168Y mutations.
-
GenBank IDNC_004102
- Promoter CMV
-
Tags
/ Fusion Proteins
- SMASh tag (C terminal on insert)
- HA epitope tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer CCTAGTTGGCAAAAGCCACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe Michael Lin lab [SMASh tag, Ref. 1], and the Atsushi Miyawaki lab [Venus YFP, Ref. 2].
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
[Ref. 1]
CHUNG H.K., JACOBS C.L., HUO Y., YANG J., KRUMM S.A., PLEMPER R.K., TSIEN R.Y. & LIN M.Z. 2015. Tunable and reversible drug control of protein production via a self-excising degron. Nat Chem Biol 11: 713-720.
[Ref. 2]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6-YFP-SMASh(TI) was a gift from Michael Lin (Addgene plasmid # 111501 ; http://n2t.net/addgene:111501 ; RRID:Addgene_111501) -
For your References section:
StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496