pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR
(Plasmid
#111502)
-
PurposeExpresses a zinc finger specific to the human VEGFA locus, which is linked to a VPR transcriptional activation domain via a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-SPORT6
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 7834
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZF(VEGFA)-StaPL(AI)-YFP-VPR
-
SpeciesH. sapiens (human); Hepatitis C Virus (HCV) genotype 1a, Aequorea victoria, Herpes simplex virus, Epstein-Barr virus
-
Insert Size (bp)3468
-
MutationThe HCV NS3 protease carries V36M, T54A, and S122G mutations. The VPR domain's internal NLS sequence was mutated to a GGSGGS linker.
-
GenBank IDNC_004102
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAGCTATGACCATTAGGCCT
- 3′ sequencing primer GTTGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bythe Atsushi Miyawaki lab [Venus YFP, Ref. 1], and the George Church lab [VPR, Ref. 2].
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
[Ref. 1]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.
[Ref. 2]
CHAVEZ A., SCHEIMAN J., VORA S., PRUITT B.W., TUTTLE M., P R IYER E., LIN S., KIANI S., GUZMAN C.D., WIEGAND D.J., TER-OVANESYAN D., BRAFF J.L., DAVIDSOHN N., HOUSDEN B.E., PERRIMON N., WEISS R., AACH J., COLLINS J.J. & CHURCH G.M. 2015. Highly efficient Cas9-mediated transcriptional programming. Nat Methods 12: 326-328.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR was a gift from Michael Lin (Addgene plasmid # 111502 ; http://n2t.net/addgene:111502 ; RRID:Addgene_111502) -
For your References section:
StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496