Skip to main content

pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR
(Plasmid #111502)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111502 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-SPORT6
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 7834
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ZF(VEGFA)-StaPL(AI)-YFP-VPR
  • Species
    H. sapiens (human); Hepatitis C Virus (HCV) genotype 1a, Aequorea victoria, Herpes simplex virus, Epstein-Barr virus
  • Insert Size (bp)
    3468
  • Mutation
    The HCV NS3 protease carries V36M, T54A, and S122G mutations. The VPR domain's internal NLS sequence was mutated to a GGSGGS linker.
  • GenBank ID
    NC_004102
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAGCTATGACCATTAGGCCT
  • 3′ sequencing primer GTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the Atsushi Miyawaki lab [Venus YFP, Ref. 1], and the George Church lab [VPR, Ref. 2].

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

[Ref. 1]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.

[Ref. 2]
CHAVEZ A., SCHEIMAN J., VORA S., PRUITT B.W., TUTTLE M., P R IYER E., LIN S., KIANI S., GUZMAN C.D., WIEGAND D.J., TER-OVANESYAN D., BRAFF J.L., DAVIDSOHN N., HOUSDEN B.E., PERRIMON N., WEISS R., AACH J., COLLINS J.J. & CHURCH G.M. 2015. Highly efficient Cas9-mediated transcriptional programming. Nat Methods 12: 326-328.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR was a gift from Michael Lin (Addgene plasmid # 111502 ; http://n2t.net/addgene:111502 ; RRID:Addgene_111502)
  • For your References section:

    StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496