pCS6-StaPLd-Casp9
(Plasmid
#111511)
-
PurposeExpresses a tandem caspase-9 dimer, governed by a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMV-SPORT6
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 6801
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStaPLd-Casp9
-
SpeciesH. sapiens (human); Hepatitis C Virus (HCV) genotype 1a
-
Insert Size (bp)2457
-
MutationThe HCV NS3 protease carries V36M, T54A, and S122G mutations. Both caspase-9 copies have had their N termini truncated.
-
GenBank IDNC_004102
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAGCTATGACCATTAGGCCT
- 3′ sequencing primer GTTGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe Guy Salvesen lab [Caspase-9, Ref. 1]
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
[Ref. 1]
STENNICKE H.R., DEVERAUX Q.L., HUMKE E.W., REED J.C., DIXIT V.M. & SALVESEN G.S. 1999. Caspase-9 can be activated without proteolytic processing. J Biol Chem 274: 8359-8362.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6-StaPLd-Casp9 was a gift from Michael Lin (Addgene plasmid # 111511 ; http://n2t.net/addgene:111511 ; RRID:Addgene_111511) -
For your References section:
StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496