pONSY-CoNMM:mCherry
(Plasmid
#111878)
-
PurposeThis plasmid expresses mCherry fluorescent protein fused to an N-Myristoylation motif (NMM) from the endogenous Src2 gene (CAOG_06360). It can be used to visualize the membrane and filopodia.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepONSY
- Backbone size w/o insert (bp) 5127
-
Modifications to backboneCapsaspora expression vector (backbone) modified from the pCR2.1 vector. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807) cloned using Restriction Enzymes and Gibson Assembly strategies.
-
Vector typeCapsaspora owczarzaki
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCapsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
-
SpeciesCapsaspora owczarzaki
-
Insert Size (bp)786
-
GenBank IDCAOG_06360
- Promoter Elongation Factor 1 alpha (EF1a) from Capsaspora
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer TATACCCGGGATGGGCTGCTCCAACTCTAAACCGCACGACCCGTCCGATTTCAAGGTTTCCCCTTCTGGCGTTGCGTCCAACAGCATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pONSY-CoNMM:mCherry was a gift from Inaki Ruiz-Trillo (Addgene plasmid # 111878 ; http://n2t.net/addgene:111878 ; RRID:Addgene_111878) -
For your References section:
Transfection of Capsaspora owczarzaki, a close unicellular relative of animals. Parra-Acero H, Ros-Rocher N, Perez-Posada A, Kozyczkowska A, Sanchez-Pons N, Nakata A, Suga H, Najle SR, Ruiz-Trillo I. Development. 2018 May 11. pii: dev.162107. doi: 10.1242/dev.162107. 10.1242/dev.162107 PubMed 29752387