pCB32
(Plasmid
#111911)
-
PurposeExpresses gRNA to target Nte1 locus and has HygR marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSMulti425 Hyg-Leu
-
Backbone manufacturerStanford Genome Technology Center
-
Modifications to backboneRemoved Leu marker and replaced with gRNA cassette
-
Vector typeBacterial Expression, Yeast Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA cassette targeting Nte1 locus
-
gRNA/shRNA sequenceGTTAGTGCAAGCTTTCAAAC
-
SpeciesS. cerevisiae (budding yeast)
- Promoter SNR52p
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agcttgtctgtaagcgga
- 3′ sequencing primer cctatggaaaaacgccagAAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB32 was a gift from Yi Tang (Addgene plasmid # 111911 ; http://n2t.net/addgene:111911 ; RRID:Addgene_111911)