pcDNA3.1(+)-NES-ZapCV2 (cpV143)
(Plasmid
#112060)
-
PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerInvitrogen (ThermoFisher / Life Technologies)
- Backbone size w/o insert (bp) 5428
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing lab uses Omnimax cells.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-ZapCV2
-
SpeciesSynthetic
-
Insert Size (bp)1693
-
MutationECFP gene is truncated 36 bp at 3' end. Venus gene is circurlarly permuted at residue 173. Zap2 zinc binding domain derived from S. cerevisiae Zap1 zinc finger domains 1 & 2 with C581H and C618H mutations.
- Promoter CMV
-
Tag
/ Fusion Protein
- Nuclear Export Signal (NES) derived from HIV-1 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer Quintara Bio: CMV Forward (5'-CGCAAATGGGCGGTAGGCGTG-3')
- 3′ sequencing primer Quintara Bio: L-12EndR (5'- GGAAAGGACAGTGGGAGTGG -3') (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)-NES-ZapCV2 (cpV143) was a gift from Amy Palmer (Addgene plasmid # 112060 ; http://n2t.net/addgene:112060 ; RRID:Addgene_112060) -
For your References section:
Droplet Microfluidic Flow Cytometer For Sorting On Transient Cellular Responses Of Genetically-Encoded Sensors. Fiedler BL, Van Buskirk S, Carter KP, Qin Y, Carpenter MC, Palmer AE, Jimenez R. Anal Chem. 2017 Jan 3;89(1):711-719. doi: 10.1021/acs.analchem.6b03235. Epub 2016 Dec 13. 10.1021/acs.analchem.6b03235 PubMed 27959493