Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1(+)-NES-ZapCV2 (cpV143)
(Plasmid #112060)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112060 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Invitrogen (ThermoFisher / Life Technologies)
  • Backbone size w/o insert (bp) 5428
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Depositing lab uses Omnimax cells.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-ZapCV2
  • Species
    Synthetic
  • Insert Size (bp)
    1693
  • Mutation
    ECFP gene is truncated 36 bp at 3' end. Venus gene is circurlarly permuted at residue 173. Zap2 zinc binding domain derived from S. cerevisiae Zap1 zinc finger domains 1 & 2 with C581H and C618H mutations.
  • Promoter CMV
  • Tag / Fusion Protein
    • Nuclear Export Signal (NES) derived from HIV-1 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer Quintara Bio: CMV Forward (5'-CGCAAATGGGCGGTAGGCGTG-3')
  • 3′ sequencing primer Quintara Bio: L-12EndR (5'- GGAAAGGACAGTGGGAGTGG -3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)-NES-ZapCV2 (cpV143) was a gift from Amy Palmer (Addgene plasmid # 112060 ; http://n2t.net/addgene:112060 ; RRID:Addgene_112060)
  • For your References section:

    Droplet Microfluidic Flow Cytometer For Sorting On Transient Cellular Responses Of Genetically-Encoded Sensors. Fiedler BL, Van Buskirk S, Carter KP, Qin Y, Carpenter MC, Palmer AE, Jimenez R. Anal Chem. 2017 Jan 3;89(1):711-719. doi: 10.1021/acs.analchem.6b03235. Epub 2016 Dec 13. 10.1021/acs.analchem.6b03235 PubMed 27959493