pcDNA3.1(+)-NES-ZapCV2 (cpV143)
(Plasmid
#112060)
-
PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Boulder
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 112060-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 112060-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerInvitrogen (ThermoFisher / Life Technologies)
- Backbone size w/o insert (bp) 5428
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing lab uses Omnimax cells.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-ZapCV2
-
SpeciesSynthetic
-
Insert Size (bp)1693
-
MutationECFP gene is truncated 36 bp at 3' end. Venus gene is circurlarly permuted at residue 173. Zap2 zinc binding domain derived from S. cerevisiae Zap1 zinc finger domains 1 & 2 with C581H and C618H mutations.
- Promoter CMV
-
Tag
/ Fusion Protein
- Nuclear Export Signal (NES) derived from HIV-1 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer Quintara Bio: CMV Forward (5'-CGCAAATGGGCGGTAGGCGTG-3')
- 3′ sequencing primer Quintara Bio: L-12EndR (5'- GGAAAGGACAGTGGGAGTGG -3')
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 112060-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 112060-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)-NES-ZapCV2 (cpV143) was a gift from Amy Palmer (Addgene plasmid # 112060 ; http://n2t.net/addgene:112060 ; RRID:Addgene_112060) -
For your References section:
Droplet Microfluidic Flow Cytometer For Sorting On Transient Cellular Responses Of Genetically-Encoded Sensors. Fiedler BL, Van Buskirk S, Carter KP, Qin Y, Carpenter MC, Palmer AE, Jimenez R. Anal Chem. 2017 Jan 3;89(1):711-719. doi: 10.1021/acs.analchem.6b03235. Epub 2016 Dec 13. 10.1021/acs.analchem.6b03235 PubMed 27959493