Skip to main content

pMAL-SH3(2)-5R
(Plasmid #112089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112089 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMal-tev
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 7900
  • Modifications to backbone
    tev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SH3(2)-5R
  • Alt name
    NCK adaptor protein 1, isoform 2, second SH3 repeat x 5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1299
  • Mutation
    construct contains only repeats of the second SH3 domain of NCK1
  • GenBank ID
    NP_001177725.1
  • Entrez Gene
    NCK1 (a.k.a. NCK, NCKalpha, nck-1)
  • Promoter Lac
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pMal-forward: GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer pMal-reverse: CGCCAGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Internal Nde site in addition to N terminal site was used to make additional repeats of SH3.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-SH3(2)-5R was a gift from Michael Rosen (Addgene plasmid # 112089 ; http://n2t.net/addgene:112089 ; RRID:Addgene_112089)
  • For your References section:

    Phase transitions in the assembly of multivalent signalling proteins. Li P, Banjade S, Cheng HC, Kim S, Chen B, Guo L, Llaguno M, Hollingsworth JV, King DS, Banani SF, Russo PS, Jiang QX, Nixon BT, Rosen MK. Nature. 2012 Mar 7;483(7389):336-40. doi: 10.1038/nature10879. 10.1038/nature10879 PubMed 22398450