pMAL-SH3(2)-5R
(Plasmid
#112089)
-
PurposeBacterial expression plasmid containing His and MBP tags for 5 repeats of the second SH3 domain from human NCK1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMal-tev
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 7900
-
Modifications to backbonetev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSH3(2)-5R
-
Alt nameNCK adaptor protein 1, isoform 2, second SH3 repeat x 5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1299
-
Mutationconstruct contains only repeats of the second SH3 domain of NCK1
-
GenBank IDNP_001177725.1
-
Entrez GeneNCK1 (a.k.a. NCK, NCKalpha, nck-1)
- Promoter Lac
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pMal-forward: GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer pMal-reverse: CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Internal Nde site in addition to N terminal site was used to make additional repeats of SH3.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL-SH3(2)-5R was a gift from Michael Rosen (Addgene plasmid # 112089 ; http://n2t.net/addgene:112089 ; RRID:Addgene_112089) -
For your References section:
Phase transitions in the assembly of multivalent signalling proteins. Li P, Banjade S, Cheng HC, Kim S, Chen B, Guo L, Llaguno M, Hollingsworth JV, King DS, Banani SF, Russo PS, Jiang QX, Nixon BT, Rosen MK. Nature. 2012 Mar 7;483(7389):336-40. doi: 10.1038/nature10879. 10.1038/nature10879 PubMed 22398450