pMAL-SH3(2)-5R
(Plasmid #112089)

• Purpose: Bacterial expression plasmid containing His and MBP tags for 5 repeats of the second SH3 domain from human NCK1.
• Depositing Lab: Michael Rosen
• Publication: Li et al Nature. 2012 Mar 7;483(7389):336-40. doi: 10.1038/nature10879.

Backbone

• Vector backbone: pMal-tev
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 7900
• Modifications to backbone: tev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SH3(2)-5R
• Alt name: NCK adaptor protein 1, isoform 2, second SH3 repeat x 5
• Species: H. sapiens (human)
• Insert Size (bp): 1299
• Mutation: construct contains only repeats of the second SH3 domain of NCK1
• GenBank ID: NP_001177725.1
• Entrez Gene: NCK1 (a.k.a. NCK, NCKalpha, nck-1)
• Promoter: Lac
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • His6 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: pMal-forward: GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer: pMal-reverse: CGCCAGGGTTTTCCCAGTCACGAC

Resource Information

• Supplemental Documents:
  • MTTH modification of pMal vector

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Internal Nde site in addition to N terminal site was used to make additional repeats of SH3.