-
PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePX551-Plasmid #60957
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 2880
- Total vector size (bp) 7278
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA scaffold
-
Insert Size (bp)121
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer ctctagaGTTTAAACAAA
- 3′ sequencing primer GCATATACGATACAAGGCTGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman-codon-optimized NmeCas9
-
Alt nameNmCas9
-
SpeciesNeisseria meningitidis-strain 8013
-
Insert Size (bp)3243
- Promoter U1a
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer caaagtttttttcttccatt
- 3′ sequencing primer gggcttcatgatgtcccc
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS654 All-in-One AAV-sgRNA-hNmeCas9 was a gift from Erik Sontheimer (Addgene plasmid # 112139 ; http://n2t.net/addgene:112139 ; RRID:Addgene_112139) -
For your References section:
All-in-one adeno-associated virus delivery and genome editing by Neisseria meningitidis Cas9 in vivo. Ibraheim R, Song CQ, Mir A, Amrani N, Xue W, Sontheimer EJ. Genome Biol. 2018 Sep 19;19(1):137. doi: 10.1186/s13059-018-1515-0. 10.1186/s13059-018-1515-0 PubMed 30231914