pQE80L TriCatcher-RGDSP-MMP
(Plasmid
#112633)
-
PurposeTwo SpyCatchers linked by an elastin-like polypeptide with an RGDSP integrin-binding site, an MMP-cleavable sequence and a C-terminal SnoopCatcher
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112633 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE80L
-
Backbone manufacturerQiagen Inc.
- Backbone size w/o insert (bp) 4714
- Total vector size (bp) 6556
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTriCatcher-RGDSP-MMP
-
SpeciesSynthetic
-
Insert Size (bp)1842
-
Mutationcentral matrix metalloproteinase-cleavable sequence and RGDSP integrin-binding sequence
- Promoter T5
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATAAAAAATTTATTTGCTTTGTGAGCGG
- 3′ sequencing primer CGAGCGTTCTGAACAAATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE80L TriCatcher-RGDSP-MMP was a gift from Mark Howarth (Addgene plasmid # 112633 ; http://n2t.net/addgene:112633 ; RRID:Addgene_112633) -
For your References section:
Assembling and decorating hyaluronan hydrogels with twin protein superglues to mimic cell-cell interactions. Wieduwild R, Howarth M. Biomaterials. 2018 Oct;180:253-264. doi: 10.1016/j.biomaterials.2018.07.020. Epub 2018 Jul 17. 10.1016/j.biomaterials.2018.07.020 PubMed 30053659