pQE80L SpyTag-ELP-SpyTag DK
(Plasmid
#112635)
-
PurposeSpyTag linked by an elastin-like polypeptide to non-reactive SpyTag DK
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE80L
-
Backbone manufacturerQiagen Inc.
- Backbone size w/o insert (bp) 4714
- Total vector size (bp) 5393
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyTag-ELP-SpyTag DK
-
SpeciesSynthetic
-
Insert Size (bp)690
-
MutationContains central cysteine. Reactive aspartic acid in C-terminal SpyTag mutated to lysine (DK).
- Promoter T5
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATAAAAAATTTATTTGCTTTGTGAGCGG
- 3′ sequencing primer CGAGCGTTCTGAACAAATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE80L SpyTag-ELP-SpyTag DK was a gift from Mark Howarth (Addgene plasmid # 112635 ; http://n2t.net/addgene:112635 ; RRID:Addgene_112635) -
For your References section:
Assembling and decorating hyaluronan hydrogels with twin protein superglues to mimic cell-cell interactions. Wieduwild R, Howarth M. Biomaterials. 2018 Oct;180:253-264. doi: 10.1016/j.biomaterials.2018.07.020. Epub 2018 Jul 17. 10.1016/j.biomaterials.2018.07.020 PubMed 30053659