pAAV Gsk3 sgRNA/GFP
(Plasmid
#112733)
-
PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX552
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 4574
- Total vector size (bp) 5306
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceGACTGTAACATAGTCCGACTG
-
SpeciesM. musculus (mouse)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPX552 plasmid is received from Dr. Feng Zhang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV Gsk3 sgRNA/GFP was a gift from Martin Beaulieu (Addgene plasmid # 112733 ; http://n2t.net/addgene:112733 ; RRID:Addgene_112733) -
For your References section:
Mental Illnesses-Associated Fxr1 and Its Negative Regulator Gsk3beta Are Modulators of Anxiety and Glutamatergic Neurotransmission. Khlghatyan J, Evstratova A, Chamberland S, Marakhovskaia A, Bahremand A, Toth K, Beaulieu JM. Front Mol Neurosci. 2018 Apr 12;11:119. doi: 10.3389/fnmol.2018.00119. eCollection 2018. 10.3389/fnmol.2018.00119 PubMed 29706865