Skip to main content

pAAV Gsk3 sgRNA/GFP
(Plasmid #112733)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112733 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX552
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 4574
  • Total vector size (bp) 5306
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • gRNA/shRNA sequence
    GACTGTAACATAGTCCGACTG
  • Species
    M. musculus (mouse)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PX552 plasmid is received from Dr. Feng Zhang

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Gsk3 sgRNA/GFP was a gift from Martin Beaulieu (Addgene plasmid # 112733 ; http://n2t.net/addgene:112733 ; RRID:Addgene_112733)
  • For your References section:

    Mental Illnesses-Associated Fxr1 and Its Negative Regulator Gsk3beta Are Modulators of Anxiety and Glutamatergic Neurotransmission. Khlghatyan J, Evstratova A, Chamberland S, Marakhovskaia A, Bahremand A, Toth K, Beaulieu JM. Front Mol Neurosci. 2018 Apr 12;11:119. doi: 10.3389/fnmol.2018.00119. eCollection 2018. 10.3389/fnmol.2018.00119 PubMed 29706865